circad | circRNAs associated with diseases

CircPSMC3
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	30777076
Experimental Method
Sample Type	Tissues, cell lines and blood sample	Comparison	One hundred and-six samples of GC tissues were matched to adjacent normal tissues and 10 ml preoperative blood venous blood were collected
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTTTAGGGTCCCTGCCCTTTG Reverse GTGTTGGGCTGGAAGCCATC	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Rong, D, Lu, C, Zhang, B, Fu, K, Zhao, S, Tang, W, Cao, H (2019). CircPSMC3 suppresses the proliferation and metastasis of gastric cancer by acting as a competitive endogenous RNA through sponging miR-296-5p. Mol. Cancer, 18, 1:25.